Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E596014

Search information 
Request: 596014Match: SGN-E596014
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C373027Clone name: 39299
nocartOrdering Not Available
Library Name: CSWBOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E596014Length: 549 bp (843 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E596014 [] (trimmed) ATTACATATATTCGACCATTGTATTACACAGCCATTACAAAAAGCCCTAAGGAAACACAAAATGCTTTCAACATGATATTCATAACCACACTGAC
ATGAGAAGAAAAAACAACTAGATAAAACTCCGCCTGCATCCAGATCAACCCACAATAACAAATCTGCATCACTTTAAGCCTTGTTAGCAATGTTG
TTAGAAAGCCAATCAAGTCCCTCGTAAAGCCCCTCTCCAGAAGTTGCACAAGTGCTCTGGATGTACCAGTGACGCTGCCTGAGGGAGTGCAGTCC
AAGCTTATCAGTTATTTCGGCAGCATTCATTGCATTAGGAAGATCTTGCTTGTTAGCAAAAACTAGAAGCACAGCATCCCGAAGTTCATCCTCGT
TCAACATCCTATGCAATTCATCTCTTGCTTCTACAACACGGTCTCTATCATTGCTATCAACCACAAAAATGAGACCCTGAGTGTTCTGGAAGTAG
TGCCTCCACAATGGACGGATCTTGTCCTGACCCCCGACATCCCAAACAGTGAAGCTGATGTTCTTGTACTCAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E596014] SGN-U268253 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T396890 [Download][View] Facility Assigned ID: bf_cswbxxxx_0038h01.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5