Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E597064

Search information 
Request: 597064Match: SGN-E597064
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C374077Clone name: 40559
nocartOrdering Not Available
Library Name: CSWBOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E597064Length: 649 bp (1078 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E597064 [] (trimmed) TTTTTTTACGTTTTGAAATAACTTGATTGTTTTTATTATCTTCAATTTAATTTCTATTGGCTATGGTTTCGTTGAGCAACATAGTAAAGATGCCT
AGGGTTTCCATGGTCACAGCAAGGGTAGTAAAACTTCCCACCGTCTTTCCTTCCGCCGACTGGATATCCCAAAGCTGGAGAACAACACCTAGCCG
CCGCCGCCGCCGCATACGACGGAGGTGAATAAAAACATCTGAGCTTTTCCGGCTTCATTCTCGATGTCGGAAAGTCAAAACACGACATTGGAGAT
GACGGAGGAGAAACTTTTTTCACCGAATTGAGAGGAAATAAAACAGCTCTAATCTTCATCTCCTGATTCGTCAACGCAGAAACTCGATCGTACTC
TTGAATCACATTCATCAGATCCTCATCACAAGTAATTGAAACTAAAACATCCAAATCCTCAGTCGGCAACTTACACTTCAAACTCATTGACGATC
CACACGATTCTCCAAACTTCACCATCAACTCTGCAAACGAAATAGACTTGTCAACAGAGAGAACTCTGGTAAAACCACCGATGTAACGGAGCTTT
CCATCGGAACGACGAGGGACGATTCTCCCGCCGTAACTATACAGAAACTTGATAACTTGTGAACCGTTCATAGAGTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E597064] SGN-U275166 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T397940 [Download][View] Facility Assigned ID: bf_cswbxxxx_0050c09.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0018 Quality Trim Threshold: 14.5