EST details — SGN-E598470

Search information 
Request: 598470Match: SGN-E598470
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C375483Clone name: 74142
nocartOrdering Not Available
Library Name: CSWBOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E598470Length: 432 bp (1043 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E598470 [] (trimmed) CGAAACTGTCTCCTTCTAGTCCATACAGCCCGTCATCTCCAAGTTACAGTCCCACATCACCATCGTACTCTCCAACATCTCCATCATATTCTCCT
TCAAGCCCAACCTATAGTCCCAGCAGCCCATACAACAACTCAGGTACAAGCCCAGATTATAGTCCCAGTTCTCCCCAGTACAGTCCAAGTGCAGG
GTACTCACCAAGTGCTCCTGGGTATTCACCATCATCTACTAGCCAGTACACCCCACGTGTAAGTGAGAGAGACAACAAGAGTGTCAAAGATGACA
AGGCTGGTTGATCATTAGGGAATAAAGTTGTATTTACTTTGCACTTTAATCTTTCAGTGGCTTATTAGTCATTACTGTGCTTTCTGAAGGCGTAA
GATTGCTGTATAATATTTTTCGAAAAAAAAAAAAAAAAAAACTCGAGACTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E598470] SGN-U277223 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T399346 [Download][View] Facility Assigned ID: bf_cswbxxxx_0066b05.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5