EST details — SGN-E600138

Search information 
Request: 600138Match: SGN-E600138
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C378232Clone name: 53142
nocartOrdering Not Available
Library Name: ACDCOrganism: Solanum tuberosum

Tissue: Sprouting Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E600138Length: 707 bp (982 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E600138 [] (trimmed) AAGGGTAGGATCTATGTAAACCCTACCCCTACCTTTATGGGGCAAAGAGACTGTTTTCAATAGACTCTTAGCTCAAAAGAATTGAAGCAAAGGGA
AGTAATCGGGAAAAAAATAAATCATTCCCCATCCCAGATCATCAACTCATGCTGCTGCACTTGAATACAGTAACATGATCTGAAGATGCTACATT
TTAAATTGTGTTAAGGTAAAATGTGATCATTTTACTGTACAGCGCGAAAGAACCATTACATATAGGGAATCACCGGAAGAACTCATTGAGGCCAT
CAATAATACTGAATGAAAATGTCGATCTCTCAGAAAAAGTAGACCCTCTTCGAACTAGGAAAAAAACGAAGAGGGGAACAATGCTGTTGGATGTG
ATAAGGAAGATTCACGAGCTTGCTGCTAAATGATTGAATATCGATTCAAGTGTTGATTGGCTGACGTTGTACTCTGATATCCCAAGCTGGTTTCT
GCTCCTCTCTATGTACCCGAAAACATCAGCGAGGGATAGACCTTCTCCACAAGGGAGCTGATACTTGACACTCAATCCATTGCAACCTTGAAATG
TGGCATCAGGAAATGAAGACTGAATGAATGAATGGATTTCGGTAAACTTCTCCTTAGCCAAGCACCAGTCACAGAATATCGGCAACTGGAGTCCA
CCATCACGAGCAACCTGCTCTGACAACTGGTCACCGAAAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E600138] SGN-U278577 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T402095 [Download][View] Facility Assigned ID: bf_acdcxxxx_0018a04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0060 Quality Trim Threshold: 14.5