EST details — SGN-E600850
Search information |
Request: 600850 | Match: SGN-E600850 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C378944 | Clone name: 53872 |
| ||
Library Name: ACDC | Organism: Solanum tuberosum |
Tissue: Sprouting Tubers
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E600850 | Length: 218 bp (894 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E600850 [] (trimmed)
CATTCACTAAAAGTTCACTGTTTATTAAAGCATTACATTTATATCCAGATCAACCTTCTTCTGCATACACAGCATAAATAACAAGGCAAATACAC
TTCCAGACACAGAAATCAAGGACTAGTATAAAGAGGCGAGTAGCTCCAGCAAAGAAGCAGCAAATTGCATTTGTGTCTCCTCGTCTATGGTTAGG
AAGAGGGGCACGTGTACAAATAGTGATC
TTCCAGACACAGAAATCAAGGACTAGTATAAAGAGGCGAGTAGCTCCAGCAAAGAAGCAGCAAATTGCATTTGTGTCTCCTCGTCTATGGTTAGG
AAGAGGGGCACGTGTACAAATAGTGATC
Unigenes |
Current Unigene builds | |||||
[SGN-E600850] | SGN-U269254 | Solanum tuberosum | Build 4 | 43 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T402807 [Download][View] | Facility Assigned ID: bf_acdcxxxx_0026f02.t3m |
Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.957 | Expected Error Rate: 0.0001 | Quality Trim Threshold: 12.5 |