Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E600893

Search information 
Request: 600893Match: SGN-E600893
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C378987Clone name: 53915
nocartOrdering Not Available
Library Name: ACDCOrganism: Solanum tuberosum

Tissue: Sprouting Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E600893Length: 652 bp (1032 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E600893 [] (trimmed) ACTAGTCTCGACTTTTTTTTTTTTTTTTTTTTTTTTTTTTACATGAAATTGATTCAGTCATAACATAAGCTTACTTGCAACATAGATGACAGTCT
ACTGCATCTTTTTCAAACTAGACAAACGAAATGTAACATGCACCAACTAAGGGGTGGGATTATTGAAAAAAACAGACGACCTCGACGACAAACTG
GAGATGCTAACAAGACACTTCAAGCAGTTCAGTAGGACCAAATCTCATCTTCCTCTGTTGCACAATCTGCAGCATTGTCTTCACTGTAATAGTAA
TAGCCACCATTATTGGCATTGGCATTGGCACTGGCAGTGGCAGTGGCTTCTGCAGTGAAGCAGCAAGACGAAGACGACGACACAAGGTAAGGCAT
GTTGTGGAAGGACTGAGCTAAGCTGCTGGTCAAAGATGCAAAGGCAAGACCTTTATCTTCTCCTTCTCCTTCTCCTTGTTCCAAGAATTCCTCTG
CACGGTGCTTGAGAGTCTCGAACATGAGTTCAGGCTCAAACTGCATCGCCCGGAGAACGTCAGCACAGGATGGGCCAGGGACAGAGCGAGTCACC
GCAAAGCTGTGAGGGCTATCGCTCTGCAACACGCGAACAAGGCTTGGTCCACCAAATAGATTGTGGAGTCCTCCGAGCGCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E600893] SGN-U269363 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T402850 [Download][View] Facility Assigned ID: bf_acdcxxxx_0027a09.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5