EST details — SGN-E601055

Search information 
Request: 601055Match: SGN-E601055
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C379149Clone name: 54081
nocartOrdering Not Available
Library Name: ACDCOrganism: Solanum tuberosum

Tissue: Sprouting Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E601055Length: 442 bp (588 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E601055 [] (trimmed) AGATCCTTTCTTTCCAACTTCTGTTTTGATGCTCTTGTAATTTTGATGTTTCATTTGGGAAGTATATCCCTATGTTTTCCTTTTGTCCAGAAGGC
TCCCATGACAAGAAGATGTCTCTGAGATAATTTGTGTTAAAAGTGTAATTTTAATTCTAATGTTTATCGACGCCTCTCTACAGAGCATCTCTAAG
GAGCAGGCAAAAAGATTTACAAAATTCCGAGAGAGGAGAGGCCTCATTGAAAAAGATGTGGTGAGGACTGATCGGTCAATTTCATTCTATGAAGA
GGATGACAGCCCAAACATTAAATGTTTGCGCGATATACTGCTGACATACTCATTCTACAACTTTGATTTGGGTTACTGTCAGGGTATGAGCGATC
TCCTTTCACCAATATTGTTTGTTATGGGAGATGAATCAAAACATTTTGGTGCTTTGTGGCGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E601055] SGN-U280615 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T403012 [Download][View] Facility Assigned ID: bf_acdcxxxx_0029a09.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0039 Quality Trim Threshold: 20.5