EST details — SGN-E602174

Search information 
Request: 602174Match: SGN-E602174
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C380268Clone name: 55230
nocartOrdering Not Available
Library Name: ACDCOrganism: Solanum tuberosum

Tissue: Sprouting Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E602174Length: 168 bp (866 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E602174 [] (trimmed) TCAACGTCTTCTTAGTCTCTCAGCTACGATGAAGGAAAGTTCAAGAGACTGAGAAGCATTCAATCTTGGGTCACAATGAGTGTGGTAGCGAGAGC
CCAAATCGTCATAGGTTACTGTTCGTGATCCACCAATGCACTCAGTCACATTTTGCCCTGTCATTTCTAGGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E602174] SGN-U270047 Solanum tuberosum Build 4 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T404131 [Download][View] Facility Assigned ID: bf_acdcxxxx_0044c12.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0004 Quality Trim Threshold: 12.5