Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E603097

Search information 
Request: 603097Match: SGN-E603097
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C381191Clone name: 56177
nocartOrdering Not Available
Library Name: ACDCOrganism: Solanum tuberosum

Tissue: Sprouting Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E603097Length: 816 bp (1133 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E603097 [] (trimmed) ACGAAGTTGACATAGCAGCAAAACCAATTGTCCCACCCAAGAAAGTTAATAGAGCTAAAATAGATGCAAGACAATATTCAATCGCAGACCTACAG
ATGGCGACTGATAGCTTCAATGTTGATAACCTTATTGGCGAGGGATCATTTGGGCGTGTTTATAGGGCTCAGTTCGATGATGGAAAGGTTCTTGC
AGTCAAGAAAATCAACTCTTCTGCACTCCAGAATCCTGAAGATTTTCTCGATATTGTTTCTGAGATATCACGGTTGCACCATCCAAATGTTACTG
AGCTGGTTGGATATTGTTCAGAGCACGGGCAGCATCTGCTGGTTTATGAATTCCACAAAAATGGTTCTCTGCATGATTTCCTGCATCTGTCAGAT
GAGGAAAGCAAGCCTCTAACATGGAATAGCCGAGTTAAGATTGCACTAGGCACAGCAAGAGCACTAGAGTATCTGCACGAAGTTTGTTCACCATC
TTTGGTTCACAAGAATATCAAGTCTGCAAATATTGTACTTGATGCAGAACTCAATCCTCATCTATCAGACTGTGGATTGGCAAGTCTAATTGCTG
ATGCAGATCAGGCATTGAACCATAATACAGGATCGGGATATGGTGCCCCCGAAGTTGCTATGTCCGGACTCTGTACCATAAAAAGTGATGTGTAC
AGCTTGGGAGTGGTTATGTGGGAACTTCTTACCGGACGAAAACTTTTTGATAGCGCAAGAACAAGATCTGAACCAGTCTCTAGTTTAGATGGGCA
ACACCTCAAGTTGCTTGATATTGAGTGCCTAGCTAAGATGGTTTGATCCCAGCACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E603097] SGN-U268912 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T405054 [Download][View] Facility Assigned ID: bf_acdcxxxx_0056c12.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0180 Quality Trim Threshold: 12.5