Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E604230

Search information 
Request: 604230Match: SGN-E604230
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C376066Clone name: 74363
nocartOrdering Not Available
Library Name: SWSTOrganism: Solanum tuberosum

Tissue: Stolon
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E604230Length: 766 bp (1158 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E604230 [] (trimmed) TTTTTTTTTTTTTTTTATTAAAACCGTTTCAGCAGCTCATCTTGGAATTCGCTATAAAAAAAAACCAGACAGGAGAAAGACATCCAAAGGTGCTA
TTGTCACTGCCCATCAAGCAACTTGGATCAAACCAAATTGCTCAACAACTCCACTATCCTCAAACGAGGCTAGAGAACCATGACAAAAGCTTCTG
GAGCCGTGTCTATGACTGGTAAAATGTTCATAACAAAATTGAAAATAGCTAATGCAATTAAACAAAACTAGTTCATCAATGCAGAATCTCATCAA
AAACACATCACTTCTTCTTTTGGGCAGCCTTGGTGACTTTGGCACCAGTAGGGTCTTTCTTGTCGACGTTCTTGACGACACCAACAGCAACAGTT
TGACGCATGTCCCTCACAGCAAAACGTCCCAATGGTGGGTACTCAGCGAAGGTCTCAACAACCATGGGCTTGGTGGGAATCATCTTAACCATACC
GGCATCACCATTCTTCAAAAACTTGGGCTCCTTCTCAAGTTCCTTACCAGAACGTCTGTCAATCTTAGTCAAGATCTCAGCAAACTTGACAGCAA
TGTGGGAGGTGTGGCAGTCGAGCACTGGGGCATATCCGTTTCCAATCTGACCAGGGTGGTTCATGATGATAACTTGGGCAGTGAAGCTGGCAGCA
CCCTTTGCTGGGTCATCTTTGGAGTTCGAGGCAACAAAACCTCTCTTAAGATCCTTAACTGCAACATTCTTGACGTTGAACCCAACATTGTCACC
AGGAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E604230] SGN-U277731 Solanum tuberosum Build 4 274 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T399929 [Download][View] Facility Assigned ID: bf_swstxxxx_0057f03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0009 Quality Trim Threshold: 14.5