EST details — SGN-E604984

Search information 
Request: 604984Match: SGN-E604984
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C386868Clone name: 57003
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E604984Length: 339 bp (988 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E604984 [] (trimmed) GAAACTTGATGATTCATTATCTACAAATATCAGTAACATTGGTCAGACTGTTGTAGTTTCTGTTGAGGAGAGAGACAAGGAACTTAAAGATTCAC
CATCTGTAAGCATCATTAGTGATGCTGTTCCAGCTGAATGGGCTGATTCGGATGCAAACGTCTGGGGTGAGGACTAGTCAGATGATTGATCGATC
CTTCTACGTTGGTGATCTTGGTCCGTGCATGATGTCTTCAGGGTGGTAGCATTGACTGATTGCATCATAGTTTTTTTTTTTTTTTTAAGTATTTC
CTCTATGCATATTATTAGCATCCAATAAATTTACTGGTTGTTGTAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E604984] SGN-U269294 Solanum tuberosum Build 4 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T411656 [Download][View] Facility Assigned ID: BF_TUBSXXXX_0066A03_T3M
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5