EST details — SGN-E605329

Search information 
Request: 605329Match: SGN-E605329
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C382162Clone name: 21246
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E605329Length: 324 bp (843 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E605329 [] (trimmed) GACGCCAATTGATGTTGCCAAACTCAACAACCAGCAGGATGTCCTAAAGCTGCTTGAGAAGGATGCATTTCTGTGAACTGGCATAGATGTTTGGT
CATGTACAATTGAAACTTTGGATGTCACAGAGTGTGATTCAAGACATCTGTACTTTGAGGATCTTAGGGATCTTATCCATACTTGATGTGTTATC
TTTGCCAGTGTATAATTTTATTGTTTTTCTAAGATTGTGCCTGTTCGAAGAATTTCCTCTGGATGTTTTGTATTTGTAAACATCTTTGCTACCAT
GTTAAATTAACCTTCCAAATTTTTTTCCGAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E605329] SGN-U268326 Solanum tuberosum Build 4 60 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T406025 [Download][View] Facility Assigned ID: bf_tubsxxxx_0004c07.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0021 Quality Trim Threshold: 12.5