Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E605354

Search information 
Request: 605354Match: SGN-E605354
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C382187Clone name: 21273
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E605354Length: 481 bp (736 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E605354 [] (trimmed) GAAGATTTGTTTACTAAGAGTGAAAGGGAAAACAATAGTTTTTGTTCATATTTTTTCTCAATTTGAAGTTGTTGAGAGTAATGGCTGGGTACAGA
GCTGAAGATGACTATGATTACCTATTCAAGGTGGTACTAATTGGTGATTCAGGTGTTGGCAAATCCAATTTGCTTTCACGATTCACTAGAAATGA
GTTTAGCCTTGAGTCTAAATCTACAATTGGTGTTGAGTTTGCTACTAAAAGCTTAACTGTTGATAGTAAAGTCATCAAGGCTCAAATTTGGGACA
CTGCTGGTCAAGAAAGGTACCGTGCCATTACCAGTGCTTACTACAGAGGTGCCGTGGGTGCTCTGCTTGTGTCTGATGTCACTCGACATTCTACA
TTTGAAAATGTTGAGAGGTGGCTTAAGGAGTTGAGAGATCATACAGATCCAAACATCGTTGTCATGCTTGTTGGAAACAAATCTGATCTGCGGCA
TCTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E605354] SGN-U278677 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T406050 [Download][View] Facility Assigned ID: bf_tubsxxxx_0004f08.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0045 Quality Trim Threshold: 20.5