Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E605779

Search information 
Request: 605779Match: SGN-E605779
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C382612Clone name: 21708
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E605779Length: 566 bp (1060 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E605779 [] (trimmed) TGGGACCACAAGTCTTTGCCCCAACCAATGATAGCCCTCCACGTCATCCATCTTATCATTATTACCCTCAACAGGGCCCACAATTCTACGCCCCA
GCCCCAGCACCAGCATACGTCGTTAGCTACAATACGGCTCAACCTACGGCTAACTATACGGCGTCGTATTATGCTCCGGCACCTCCAACTTCGTA
TGCGTATACGTATCCCGGTCCTAGTCATGTAACGGAACCTCCACCATCCGATGTGGATATGTATCCACGCCAGCCGTTGGATTCGTTTGAAATGT
TTAGTGATGAAAATCCTAACGGATGTTTTATTATGTAATGCAATTACAAAATCCTACGTAGGGTTTCGTGTATACAGGCTTATACTACTTGTATA
AGTACATGTATTATGTAGATATAAGTATAAAAATGGAGAAATTAGGGTATAATTTAGAAAATGTTAGGTGTTAGTGTTGGGGGTCTTTAATCTTT
TAGTGGGTTGTTGCCTCTTTGTTGAAGTTTGTAGCTTTATTTAGTAAACATTTTCGTTTTTTAGTCTTAAAAAAAAAAAAAAAAAAACAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E605779] SGN-U276535 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T406475 [Download][View] Facility Assigned ID: bf_tubsxxxx_0009h07.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0019 Quality Trim Threshold: 12.5