EST details — SGN-E606319

Search information 
Request: 606319Match: SGN-E606319
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C383152Clone name: 22260
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E606319Length: 233 bp (977 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E606319 [] (trimmed) AAATTTTGGATTAATGCACATATTATACTATACTATACTAGAAAACAGTGAACAAGAAATTAGCAGTCCAAAAAATAATAAGGGTGTTACACAAG
GTATACTCCTTTTTTTTTCTACTGGTATTTTTTTTCATTTTGAGCTTCAATTCGCGTTTTCTTCTCAATCTTGATCTTCCTTAGGACGCGAGGAA
GACGTTGATCCTGTTGCCATATTCACAGCTTCTCCGTGTGTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E606319] SGN-U281085 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T407015 [Download][View] Facility Assigned ID: bf_tubsxxxx_0015g08.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0042 Quality Trim Threshold: 14.5