EST details — SGN-E606705

Search information 
Request: 606705Match: SGN-E606705
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C383538Clone name: 22654
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E606705Length: 451 bp (875 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E606705 [] (trimmed) CCGTGTGTTTGAAGCTGCTCCTCAGGAATTCAAGAGGAGCACCTGCTAAAAAGCCTCCACCAGATTACTTCCTGTAGGACGACCCAAATGATTCC
AATTTTTGCCATCAATATACGCATATTGTCGACAATATGGTTGTGTAGAGCAGATGCAGGAGTTGCTCTCACACGATTCATTTTGGTAGAAAGGC
TTCTTGGTTTACAGAAAGAATGGTACCGTTGTTGGGGTTTCTAAGATTACTGAGGATCTGAATGCATGTCGCCCATTTTGAAATCTCATACATGT
TATTTTTTCCTTGTAATGGTGGTGTGTGTAATAGAATGGTGGGACATTGAAGTGAAAGTTGCAATTATGAGGCAACTTCGCACCCTTTTTTGAGC
ATCTTGTTACATCTGGACTTTGGTAAATCAGTAAATGTTTCTTTGTCCTATGTTTGCATAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E606705] SGN-U271408 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T407401 [Download][View] Facility Assigned ID: bf_tubsxxxx_0019h07.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.962 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5