EST details — SGN-E607973

Search information 
Request: 607973Match: SGN-E607973
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C384806Clone name: 23950
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E607973Length: 235 bp (994 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E607973 [] (trimmed) GGATCAACTGGCAAAGGTCTGCAAAAACTGTTGCTGTACCAAGTTCTTTATGCCCCATTCAACATTCCAGCTATGCTTGTTGTAGATTTTATCAA
GATATTTCCACAAAATATCAAGTAGAACTGTGTGTCGAGAGATTTGTAACGAAATTTCTTACATTTGCTTCTTTTTTAAAATGTGATTCCCAGTG
GTATTGAAGTGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E607973] SGN-U273293 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T408669 [Download][View] Facility Assigned ID: bf_tubsxxxx_0033h07.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.891 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5