EST details — SGN-E608710

Search information 
Request: 608710Match: SGN-E608710
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C385543Clone name: 24703
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E608710Length: 344 bp (838 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E608710 [] (trimmed) TTTTTTTTTTTAAAACAATATATAGAAACTGCAATTAAAATACAATCCTCTCAAAATACAAAAATTAAGCTCCCCTTAACAAGATCCTCCAAAAA
AATCAAAGTGAATATATAATCCAAGTACAGGCAAGGAAATGGGCCATCATCATCATCATCCTAAGCTAAATAAAGAGATAGCAATTCATACATAT
AGAGGCAAACTAAAACAAATGATGCAGGATGAAAAGAGAGCTCTACATTAGAAAGCAGAGTAGACCCCATCCTAAGACCAAGCTTTTCACAACCA
TTGTTGACATCTTCAGGCCCTCCACTCCACTCTGATCAGTAGCTGAAGGGGCAGGAGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E608710] SGN-U275370 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T409406 [Download][View] Facility Assigned ID: bf_tubsxxxx_0041g04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0002 Quality Trim Threshold: 12.5