EST details — SGN-E610101
Search information |
Request: 610101 | Match: SGN-E610101 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C387114 | Clone name: 57255 |
| ||
Library Name: TUBS | Organism: Solanum tuberosum |
Tissue: Tubers
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E610101 | Length: 241 bp (1022 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E610101 [] (trimmed)
CTGATTCGGTTACTGCAAAATGGAGTAGCAGCTCAACAACACCCAATGGCAGTACCTAGCATTTGGTTCTCTAAGGTGGTGCACTCGAACGCCTT
CCATGTTGGTTTCCAAAACCTGAATTACATACACTTTGATTACCTTGGTTTTCTCTGTTAAAGAGGATGTACATATGTCAGTGCAGCACGTTTAA
TGATTCGATTTGAACTTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
CCATGTTGGTTTCCAAAACCTGAATTACATACACTTTGATTACCTTGGTTTTCTCTGTTAAAGAGGATGTACATATGTCAGTGCAGCACGTTTAA
TGATTCGATTTGAACTTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Unigenes |
Current Unigene builds | |||||
[SGN-E610101] | SGN-U273398 | Solanum tuberosum | Build 4 | 5 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T411072 [Download][View] | Facility Assigned ID: bf_tubsxxxx_0056f12.t3m |
Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.924 | Expected Error Rate: 0.0009 | Quality Trim Threshold: 12.5 |