EST details — SGN-E610464

Search information 
Request: 610464Match: SGN-E610464
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C387477Clone name: 57626
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E610464Length: 269 bp (730 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E610464 [] (trimmed) GAACTAGTGGATCCCCGCGGCTGCATTGAGGTCATGATCTTGTTGATCATCAAAGGCAATTGGTTTTTCACTTAGAGGTTGGGAAAACCAAGTTT
TGTTGGATACCCTTTCTTTATGTTCCTCCATTTTTTCTGTAATCTTAAGTACTTGCTGAGTGAGTATATTTCCTTGGTCGTAGTTGGCTAATCAA
TGCACTGTTTTCAACTGATGTAATTTAGGGCCAACATTACTAGCAAGTTGTGATATTGTTGTTGTTACCAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E610464] SGN-U271955 Solanum tuberosum Build 4 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T410230 [Download][View] Facility Assigned ID: bf_tubsxxxx_0060f04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0117 Quality Trim Threshold: 14.5