EST details — SGN-E610722

Search information 
Request: 610722Match: SGN-E610722
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C387735Clone name: 57889
nocartOrdering Not Available
Library Name: TUBSOrganism: Solanum tuberosum

Tissue: Tubers
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E610722Length: 649 bp (756 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E610722 [] (trimmed) GATTTTGCTGAATACTACCGATCATCAGCTTTGCATCAACGAAACAAGGCTCTTGTCAATGATTTGAGCACACCTCCTCCTGGAGCCAAAGACCT
CAACTTTACCACACAATATTCCCAGCCCACCTGGGGCCAGTTCAAGTCCTGCTTATGGAAACAATGGTGGACTTACTGGAGAAGTCCAGACTATA
ACCTTGTCAGATTCTTCTTTAGTCTGGCTGCAGCGCTAATGATAGGGACAATTTTCTGGAACGTTGGCAGTAAAATAGAAAGTAGCAGTGATCTA
ATGATAGTCATCGGGGCAATGTATGCAGCTGTACTGTTTGTTGGAATCAATAATTGTTCGACTGTACAGCCAATTGTAGCCGTTGAAAGAACCGT
CTTTTATAGAGAAAGGGCTGCTGGGATGTATTCAGCATTACCATATGCTATGGCACAGGTAATTGCAGAAATACCATACATACTCGTCCAAACAA
CATACTATACTCTTATAGTGTATGCTATGATTGGCTTTGAGTGGACGGCGGCTAAATTCTTCTGGTTCTTTTTTGTAACCTTCTTCTCCTTCCTA
TACTGGACATACTATGGAATGATGACTGTTTCCATCACACCGANACCACAAGTTGCTGCGATCTTTGCTGCAGCATTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E610722] SGN-U280764 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T410488 [Download][View] Facility Assigned ID: bf_tubsxxxx_0063d08.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5