EST details — SGN-E610968

Search information 
Request: 610968Match: SGN-E610968
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C387981Clone name: 60712
nocartOrdering Not Available
Library Name: MXLFOrganism: Solanum tuberosum

Tissue: Leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E610968Length: 279 bp (387 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E610968 [] (trimmed) GACGTGTCATCAACCATTGATTCTTCACTCACCATGGTCATGGGAGATGACATGGTTAAGGTTATTGCTTGGTATGACAATGAATGGGGTTACTC
ACAGAGGGTTGTTGATCTTGCTGACATTGTTGCAAACCAGTGGAAATGAAACATGAAAATAAAATAAAGCAGTACTACTAAATAGTGGCTTAATT
TATATATTTTTAATCTTGTTTGTAGATTCTTATTCCTTTTTGAAAATTGTAATGAGAACTATAACAATTTTCCACCTTGTCAAATCTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E610968] SGN-U268660 Solanum tuberosum Build 4 84 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T413456 [Download][View] Facility Assigned ID: bf_mxlfxxxx_0002b02.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.934 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5