EST details — SGN-E611902

Search information 
Request: 611902Match: SGN-E611902
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C388915Clone name: 61659
nocartOrdering Not Available
Library Name: MXLFOrganism: Solanum tuberosum

Tissue: Leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E611902Length: 444 bp (716 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E611902 [] (trimmed) GTTTATATATGTTTAGGGTTGAAAAGAACAGGTAAGAGTTGTAGGTTACGTTGGGTTAATTATTTGAATCCTGATCTCAAACATGGAAAGATGAC
TCCTCAAGAAGAACGTCTTGTTCTTGAACTTCACTCCAAATGGGGAAATAGATGGTCAAGAATTGCCCGAAAAATACCAGGGCGTACTGATAACG
AAATTAAGAATTACTGGAGAACCCATATGAGGAAGAAAGCTCAAGAACAGAGGAAAAAGTCTTCTATTTCTCCATCTTCATCATCTTCTTCTTCT
TCAATCACTCACGAAGAAAATGAAAGAAACTTCTACGATACGGGTGGAATCAAGCTCTTGCAAAGTTGAAGGAGAAAAGAAATCTAGTGATCAAG
AACAACATGGAAAAAGTATGACAAGTTTACTCTATGGATGAAATTTGGAAAGATATGGAATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E611902] SGN-U270956 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T415880 [Download][View] Facility Assigned ID: bf_mxlfxxxx_0012e06.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5