EST details — SGN-E612275

Search information 
Request: 612275Match: SGN-E612275
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C389288Clone name: 62036
nocartOrdering Not Available
Library Name: MXLFOrganism: Solanum tuberosum

Tissue: Leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E612275Length: 242 bp (926 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E612275 [] (trimmed) GTTAACAACAACGCCTGGGCCTTTGCCACAAACTTCGTTCCCGGAAAATGAGTGTAGCAAAAAATAGATCTCTAATCTTCAAGTAGTGTGAGATG
AGTTTTTAGGTTTTGAGTGAAGAATCTATAGAAGGGGTCAAATTTTTAAGCATTCTGGGTTATGGGTTCAGTAAAGAGATTGTAATGCACTAATG
TGGTGTAAATTGGTTTGGATTAATGAAGAACATGTGAATCTTTTCATAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E612275] SGN-U281248 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T411848 [Download][View] Facility Assigned ID: bf_mxlfxxxx_0016e08.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.922 Expected Error Rate: 0.0011 Quality Trim Threshold: 12.5