EST details — SGN-E612975

Search information 
Request: 612975Match: SGN-E612975
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C389988Clone name: 62744
nocartOrdering Not Available
Library Name: MXLFOrganism: Solanum tuberosum

Tissue: Leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E612975Length: 742 bp (917 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E612975 [] (trimmed) GACTAACTCAACCATAGAAACTTTTATTCATGAGAAAAATACAACGACTTAAAGTAATCTCACACACAAAGGAATGCATACCCTCCTCTCTTATT
TGCACAAAAGGAAATATAACAAAACAAACTCATACTTTTAACTTTTAGTAGCAGATATGAAATCCCTAGTGGCATCAAATAAGATTGCAGCCAAA
GATGGCTCAAAGAACTCAGCAACATGGTAACCATCTCCAAAGAGCTTGAAGGTTTTTATACCTTTCTCTTCCACAAAATTAGCAAAGTTGCGCGC
GCCATCAACCAAAGGATCTTCAGAGACACCGGTTACAAGGATCCCCCAGCCTCGTGTGACCATATCATCTAAATGCTTTGACCCTCCGTTAAGAA
ATGGATTAGAATATTCATGATCATGATCCAATGTTCCTTTTGGTAAGGACAAGTCAAACATCTTGTCAATTGCATGTAATGGCAAAAGTTGATCA
TCCTTTAGCTTCTCTTCGGATTCTGTCCTGTTTTTGCCACTAAAATATGGTTGATGCAAGATTAGCCCTTTGATCTTCACTGGCTCTAGTTCTTT
GTATGATGAAGATGCTACGCGTAATCCTGCATGGTAAGCCATGTTTCCACCAGAACTGGATCCAAAAAGATAAACGTTACTCAAATCAGAATAAT
TTCGAATCCATTCATCTTGAGTTGATTTAATCCAATATAACCCGTCTATGGCATCATCGTAAGCTGCAGGAAGTCGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E612975] SGN-U271171 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T415033 [Download][View] Facility Assigned ID: bf_mxlfxxxx_0024f01.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0014 Quality Trim Threshold: 14.5