EST details — SGN-E613153
Search information |
Request: 613153 | Match: SGN-E613153 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C390166 | Clone name: 62924 |
| ||
Library Name: MXLF | Organism: Solanum tuberosum |
Tissue: Leaves
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E613153 | Length: 206 bp (900 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E613153 [] (trimmed)
ATAAAAGTGAATTTCTAAACATGAGAAACAATCAACGTAACGTTTAAGTAAGGGGAAACACAATGCAACCCAACTATACAGGAGCATTACTGGTT
TACTTAAACGATTGCCGCACTGGAGGCTGAAAGGGAATATATGAGTAAATTCCCAGATAATATATCTATATATGCAACATTTTACAAGAATTTTT
CTATGGAGGTGGTAAG
TACTTAAACGATTGCCGCACTGGAGGCTGAAAGGGAATATATGAGTAAATTCCCAGATAATATATCTATATATGCAACATTTTACAAGAATTTTT
CTATGGAGGTGGTAAG
Unigenes |
Current Unigene builds | |||||
[SGN-E613153] | SGN-U270896 | Solanum tuberosum | Build 4 | 17 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T414620 [Download][View] | Facility Assigned ID: bf_mxlfxxxx_0026f05.t3m |
Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.925 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 12.5 |