EST details — SGN-E613520
| Search information |
| Request: 613520 | Match: SGN-E613520 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C390533 | Clone name: 63296 |
| ||
| Library Name: MXLF | Organism: Solanum tuberosum |
Tissue: Leaves
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E613520 | Length: 184 bp (1086 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E613520 [] (trimmed)
CGGAAGGTTAGTGCAAATTCTGGAAAGGGAAAATGAAAATGTGAAAAAAAGTGGAAGAAAATTGTATCATTTAAGGTTTAGTTGTTGGATAGGAG
GATACGTTTTGTAGCTTGCGGGGACTTGCATCGGCCCCCTTCGATTTTGTAACGTTGGTTCTTTCTCACATTCCTTTTCAAAAAAAAAA
GATACGTTTTGTAGCTTGCGGGGACTTGCATCGGCCCCCTTCGATTTTGTAACGTTGGTTCTTTCTCACATTCCTTTTCAAAAAAAAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E613520] | SGN-U271063 | Solanum tuberosum | Build 4 | 14 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T412452 [Download][View] | Facility Assigned ID: bf_mxlfxxxx_0030g06.t3m |
| Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.915 | Expected Error Rate: 0.0002 | Quality Trim Threshold: 12.5 |
Working
