EST details — SGN-E614420
Search information |
Request: 614420 | Match: SGN-E614420 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C391433 | Clone name: 64206 |
| ||
Library Name: MXLF | Organism: Solanum tuberosum |
Tissue: Leaves
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E614420 | Length: 159 bp (463 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E614420 [] (trimmed)
GCATTTCCAACTTTCCGAACTTCATCCCCAATCACATAATCCTCCTGACAAATACTGCATTTGATCTCAGTTCATCCCCATCACCTCCAAATACC
CCTAGTTCCGAGTGCATGCCTTGATAAATGCTTCTTTGAAGACACTTTGATACTGCTCCTCCGG
CCTAGTTCCGAGTGCATGCCTTGATAAATGCTTCTTTGAAGACACTTTGATACTGCTCCTCCGG
Unigenes |
Current Unigene builds | |||||
[SGN-E614420] | SGN-U273451 | Solanum tuberosum | Build 4 | 8 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T412221 [Download][View] | Facility Assigned ID: bf_mxlfxxxx_0041b06.t3m |
Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.920 | Expected Error Rate: 0.0139 | Quality Trim Threshold: 14.5 |