EST details — SGN-E614755

Search information 
Request: 614755Match: SGN-E614755
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C391768Clone name: 64546
nocartOrdering Not Available
Library Name: MXLFOrganism: Solanum tuberosum

Tissue: Leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E614755Length: 590 bp (927 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E614755 [] (trimmed) CCAGGATATACGGCTCCACCTCCTAAGAAGAAGGCCCACTTGGTTGATAATAATAATAATAATACAGCTGCAATTATTAGAGGAAGTGGAGAAGC
AGATATAGAAAATGGAAGGGAAAGAGTAGAGTCGGATTCAGAATCAGAAGGAAGAGAAATGTTGGTGATGAGTACTCAGTATTATGAATGCACAC
AAGCTGCCGATAGAAGCGCGTCTTGCTGTCGAACTATTGCTCTTATCTTCACAATTCTGCTTATGATGAGACATTTGTTAGAGGTGATGAATGGA
GGAGCAAAAAACTATCCCTTTACACTTCCTACATTGCTAATTATTAAATCCACTGGAATACTCTTGCCCATGTACATTATACTAATGTTAATCAC
AAGAATTCAGATTATCATTAGACATCATTATCTGGATTCAGAAGACAGGCTATCCAATTCTGACCAAGACAACTAATACAAGTGTTCAATTTGCA
TATTCTTTTTCATTAACAGTGTAATTTTTATTTCTAAGCATCGTACTGATGCTTATCTAATTGTTTTTTTTTCATACACGTGGAGAGTAATTAAA
AGTTTCACAAAAAAAAAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E614755] SGN-U277057 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T414684 [Download][View] Facility Assigned ID: bf_mxlfxxxx_0045h04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0021 Quality Trim Threshold: 12.5