EST details — SGN-E616792

Search information 
Request: 616792Match: SGN-E616792
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C393805Clone name: 90262
nocartOrdering Not Available
Library Name: MXLFOrganism: Solanum tuberosum

Tissue: Leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E616792Length: 538 bp (1192 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E616792 [] (trimmed) CATCAACTAGATATGAGAAGGCTGCTAAATTTATTGAAGATGATACTGACTTTAGTGAAGAGGAAAAGAAACAAGCTAAAGCTTTGAAGATCAGC
TGCAACTTAAATAATGCAGCTTGCAAGTTGAAACTGAAAGATTACAAGCAGGCGGAGAAGCTGTGTACCAAGGTGTTGGAAACTGAGAGTACTAA
TGTTAAAGCTCTTTACCGGAGAGCTCAAGCATATATGAACATGACAGATCTTGATCTAGCTGAATTTGACATAAAGAAAGCCCTTGAGATTGATC
CTAACAACAGGGATGTGAAGCTTGAATACAAAGCTCTGAAGGAGAAAGTTAAGGAATTCAATAAGAAGGATGCAAAATTCTATGGGAACATGTTT
GCTAAGTTAAATAAGTTGGATGCCCAACTAGATGTAAGTTTCAGACACCATGATTTCTAGAGTCTATTGTAGCTCCATGTTGTTTTGATGACCAG
TTCATGACACACTTTATCTTTGGTGCAAAAAACTCGCGCTTCCAAGAAACCACAAACCAAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E616792] SGN-U268749 Solanum tuberosum Build 4 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T414666 [Download][View] Facility Assigned ID: bf_mxlfxxxx_0068c12.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0134 Quality Trim Threshold: 14.5