EST details — SGN-E617251

Search information 
Request: 617251Match: SGN-E617251
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C394264Clone name: 90727
nocartOrdering Not Available
Library Name: MXLFOrganism: Solanum tuberosum

Tissue: Leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E617251Length: 684 bp (1100 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E617251 [] (trimmed) TCGGCACGAGGCCTGAATGAAATGGCAGCTATGATGAGCCAAAATAAGTCCAATGAAAATCAGGAAGAAACCTTTGGGGAATTGCAGGATATGTT
TGACGAAATGTTCAACAGTGATAATGGGATGTTTTCTTCTTCTCGGACTGGAACTCCTTCAATGTGTTCTACTTCATCGTCTACATCTTCCAGTG
AGACCTTTTTTACCTTTTCCAACAAAAGAAGTTCAGGTGAAATGAAGTCGGGTAAAGGCGATTCTTGCCAATTCCAAGGATTTTGTGAAGGGACA
GGTGGAACATCTGGAAAAAGCAATGAAAGAGAACGGAGTTGGAGGAAAAATTCCACGAGTGGACGGAAGCAATAGGATGGATGCTAAAAGGCAAA
AGGTTCTATCATGAGTTTTATCAAATTAAGGATAGGGAAAATGAATAGAACTGCAGCTAATCCATGTCTTTTTGTGGCTGTTGTTTCTTATTTAG
GATCAGAGTTGTTTCTTTTTCACAGAAAGTAGCATCTTCTTTCAACTAGTGTATTGTAATTCTATCTACCTAAAAAACGTTTTCACCAGACATCA
ATTATCTTACCATTCCTAGTATTTCATAGCTTCAATTCTTTCTTCAATGCTTAAAAACATATTGTATTGCTTATTGAACCAAATTATATTACTGT
AGTAATTTCCAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E617251] SGN-U270209 Solanum tuberosum Build 4 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T416124 [Download][View] Facility Assigned ID: bf_mxlfxxxx_0073f06.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.959 Expected Error Rate: 0.0005 Quality Trim Threshold: 14.5