EST details — SGN-E618368

Search information 
Request: 618368Match: SGN-E618368
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C395381Clone name: 69045
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E618368Length: 701 bp (1093 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E618368 [] (trimmed) AGTGGATCCCCGGGCTGACGAATTCGGTAAGAGGAAAAACAGTAGATCCAAAGTCCACTCATCAAACTCATAATTTTACCCTTTGAATTCACCTT
TTGTATGATTGAGAAGTAAATAGTAGTTCCCTTTTTCTTCTCTGATTCTTCATATTTTCAAGAATTGTGTGTTTTTCTGTAAATACATTTGTATG
GTGATGAGCTAGCTGTGAACCCATCAAGAAAAAGGGGAATTTTTTTATTGAAATTAAGAGAATCCCCATGGATTTTCTGAGAATTACTTCTCTAA
TTTTCATCTGTGGAGTTCTACTGAACTTTCCTGCTATAGTTACAGCTGGTGATATTGTTCATGATGATGACTTAGCTCCCAAGAAGCCTGGTTGT
GAGAATGATTTTGTGCTGGTGAAAGTTCAAACTTGGATTAATGGGGAAGAGGATGCAGAATTTGTTGGTGTTGGTGCTAGATTTGGCACTACTAT
TGTGTCAAAGGAGAAAAATGCACAACAAACTCCGCTTACTCTTTCTGACCCTCGGGATTGTTGCAAGCCTCCAAGGAAAAAGCTTTCTGGAGAAG
TCGTCATGGTAGATCGCGGCCAGTTGCAAATTCACAACGAAGGCTAATAATGCTGAAGCAGCAGGGGCTTCGGCAATCCTGATAGTAAATAATGA
AAAAGAACTCTACAAGATGGTTTTGTGATCCTGGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E618368] SGN-U281960 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T419244 [Download][View] Facility Assigned ID: bf_mxflxxxx_0011a12.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0032 Quality Trim Threshold: 20.5