EST details — SGN-E618440

Search information 
Request: 618440Match: SGN-E618440
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C395453Clone name: 69118
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E618440Length: 711 bp (1011 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E618440 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTATGTATAATATGTAGGATTCATAAGTACTCAAATGGCAAATTCATACCAGCATTAAGATAAACAGATTAT
TACATTCAAGAAAAGAGGAGAGGGTGGAATTACACTGGAAAACAATCACCAAATACCAAAAAAGAAGCAAGAGACAAAGCTAAAAAGAATGCCAA
TGGCTGAGTTTACCACAAAGCAGCAATCAAAGGCAACTAGGACTACTATCATCATCATCAGCAGCAGCAGCAGCACCTGGCGCCTCACTTGAGCT
CGAAGAACCACTGCTAGTAACACATGCTCCTCGCTTCTTGCGCTCCTCTTCATATTCAGGATCATCTGTGGGCAATTCAAACCTACAGACTGGAC
AAGAATTCCTCGAACCCAACCACTGAACTATACAATCATCATGGTAACCATGCCCACAGGGCAAATTCTTTGCCATTTCGCCCACATTCACTACA
TCTTTACAAATGGCACATGCCATTACCTCCTGCTCTTCCTTGATCACCAATGTATTGAGACCCTCAATTGCACTCTTGGAAGCTGGTGGAGCTCC
TCGTCTTCCGTTACATCACTCTCGGCTAGGGTTTGCAGTAAAGCTTCATAACCCGCTGCGTCCACATAGTCTCCAGGGTTCCCGATGTAGCCATT
CGCATCAGGAACTTGAAATCGGGAGCTCAATAGAGTGGTCTTCCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E618440] SGN-U271831 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T419316 [Download][View] Facility Assigned ID: bf_mxflxxxx_0011h02.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0035 Quality Trim Threshold: 20.5