EST details — SGN-E618509

Search information 
Request: 618509Match: SGN-E618509
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C395522Clone name: 69188
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E618509Length: 479 bp (1030 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E618509 [] (trimmed) CGAGGCTTTAGGACTGGAACTCCTTCAATGTGTTCTACTTCATCGTCTACATCTTCCAGTGAGACCTTTTTTACCTTTTCCAACAAAAGAAGTTC
AGGTGAAATGAAGTCGGGTAAAGGCGATTCTTGCCAATTCCAAGGATTTTGTGAAGGGACAGGTGGAACATCTGGAAAAAGCAATGAAAGAGAAC
GGAGTTGGAGGAAAAATTCCACGAGTGGACGGAAGCAATAGGATGGATGCTAAAAGGCAAAAGGTTCTATCATGAGTTTTATCAAATTAAGGATA
GGGAAAATGAATAGAACTGCAGCTAATCCATGTCTTTTTGTGGCTGTTGTTTCTTATTTAGGATCAGAGTTGTTTCTTTTTCACAGAAAGTAGCA
TCTTCTTTCAACTAGTGTATTGTAATTCTATCTACCTAAAAAACGTTTTCACCAGACATCAATTATCTTACCATTCCTAGTATTTCATAAAAAAA
AAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E618509] SGN-U270209 Solanum tuberosum Build 4 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T419385 [Download][View] Facility Assigned ID: bf_mxflxxxx_0012f01.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0021 Quality Trim Threshold: 12.5