EST details — SGN-E618817

Search information 
Request: 618817Match: SGN-E618817
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C395830Clone name: 69499
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E618817Length: 294 bp (728 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E618817 [] (trimmed) CTGATATCTTGGCTAGGCCAGCTTGGTCTAAGACACTTGAGTTGTCAAAACAGTAAGATTAGTGGCGGATGGTTGAGTAACGCGTTGGAAGGAAG
GGGGAACAACAGTTGGAAACGGCTGCTAATACCTCCTAGGCTGAGGAGCAAAATATGGCCTATGTATTACTACTAGGTTAATAAATTTAGGCCAT
AAGTAACACTTTTGTAATTTTTTGCTTTGTGGTGCACTCTTTTTGTTCTTCCTATCTTTCTTGTATCGTAAGACGTTCTCTTTTATTGAAAAAAA
AAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E618817] SGN-U268920 Solanum tuberosum Build 4 58 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T419693 [Download][View] Facility Assigned ID: bf_mxflxxxx_0016c10.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0023 Quality Trim Threshold: 14.5