Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E618959

Search information 
Request: 618959Match: SGN-E618959
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C395972Clone name: 69643
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E618959Length: 547 bp (710 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E618959 [] (trimmed) ACACCAATTTTGTCGTAGAAAAAGAGAACGAGCCAATGAAAGTCAAGATTTTGCAATGGCATGCGGTTTCTTCATGGACATGGGATGCTCAGGAT
GAAACTTGTGGTATATGTAGGATGGCTTTTGATGGTTGCTGTCCTGATTGCAAACTCCCTGGTGATGATTGTCCACTAATATGGGGTGCTTGCAA
CCATGCATTTCATCTTCATTGTATTTTGAAGTGGGTGAATTCTCAATCTGCTCAAGCACATTGTCCCATGTGTCGTCGTGAATGGCAGTTTACAG
AATGAACAATAGTTCCGTGCATCTTTTGCTCATGAATGTGGCAGTAGGAAGGAATGAAGTGTCTTGTGTGTGATACTATGAAATTCTAGCGATAA
TAGCTGAGCTGATATGTGCTCATCCCCATATACAATTATTAGTTTAAGCTTTTAAGGCCTAGAATAGATGGTGTATTCTATCAGACTTGGTTGCA
AGTGCAGATATGCTATTAGCCATTTATCCCAAAAGTCCTCAATACACCAGTTGCCAGGCATTGCTTGAGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E618959] SGN-U284807 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T419835 [Download][View] Facility Assigned ID: bf_mxflxxxx_0017h06.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5