EST details — SGN-E619026

Search information 
Request: 619026Match: SGN-E619026
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C396039Clone name: 69711
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E619026Length: 548 bp (623 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E619026 [] (trimmed) TGATTGTGTTGCTCAGTACTATGATATTCCAGATATCGAGCGAACAGATGAAGAGATCAACATGCTTCGGCAGATTGCTGTTGATTGCCCTAGAA
CAGTGCCTGATGTTTCTTTTTTCCAACAAGCACAAGTTCAGAAATCCCTGGAGCACATACTTTACCTATGAGCTAAGAAAGTACAAGCAATCGTC
CAACACACATGCAAGGGCTTGAGTTTCTCCAGTTTGCTTTTCGCTGGTTCAATTGTCTCTTGATACTCGAGATCCCTTTCCATCTTGTTACCCGA
TTATGGGATACATATCTTGCAGTAGGTGATGCACTGCCAGATTTTCTTGTGTATATAGCTGCAAGCTTTCTTCTCACAATAAGCTGCTGAAGCTC
GACTTCCAAGAGATGGTTATGTTCCTTCAACACCTTCCAACTCATAACTGGAGTCATTCTTCTCATAAATGATGTGTTTAATTAGAGAGAGTCCA
TCAAATGTAAAACAAATTGAAAGCCTTATTGTTAACTTCATATGTGATAGTTGTATACTTCACTCTGCTCCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E619026] SGN-U273276 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T419902 [Download][View] Facility Assigned ID: bf_mxflxxxx_0018f08.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0012 Quality Trim Threshold: 14.5