EST details — SGN-E619302
| Search information |
| Request: 619302 | Match: SGN-E619302 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C396315 | Clone name: 69990 |
| ||
| Library Name: MXFL | Organism: Solanum tuberosum |
Tissue: Floral buds
Development Stage:
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E619302 | Length: 177 bp (1297 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E619302 [] (trimmed)
CTGTGTTTAGCATTGTTGTACTTCTTTTCGAGTGTAGCTTAACTAACTAGCAACGAATAGAATGACCATCTTTCTGGCTTCGGTTCGTGCTATAG
TTCTCACATTCTGCTATAACATTGATTTTCCAACAATGCGATGAAGTGCATAGAATGTAGTTTAAGCATTTCAAAAAAAAAA
TTCTCACATTCTGCTATAACATTGATTTTCCAACAATGCGATGAAGTGCATAGAATGTAGTTTAAGCATTTCAAAAAAAAAA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E619302] | SGN-U278419 | Solanum tuberosum | Build 4 | 4 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T420178 [Download][View] | Facility Assigned ID: bf_mxflxxxx_0021g02.t3m |
| Submitter: Rebecca Griffiths | Sequencing Facility: GASF |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.927 | Expected Error Rate: 0.0002 | Quality Trim Threshold: 12.5 |
Working
