Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E619448

Search information 
Request: 619448Match: SGN-E619448
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C396461Clone name: 70137
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E619448Length: 813 bp (984 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E619448 [] (trimmed) CTTTAAGACAGAAGAATGGCTCAAGCAACACCTAATCACACACAAACTGTTTCTGGTTGGGCAGCTCATGATTCTTCTGGAAAAATCACACCTTT
TAACTTCAAGAGAAGAGAAAATGGTGAGAATGATGTGACCATTGAGATCTTGTATTGTGGAATGTGTCATACGGATATTCATCATGTCAAGGATG
ACTGGGGCATTACTAAGTACCCTGTTGTGCCTGGGCATGAAATTACTGGGATTATAACAAAGGTGGGAAGCAATGTAAGTAAATTCAAGATGGGA
GACAGAGTAGGGGTAGGTTGCTTGGCAGCAACATGTTTGAAATGTGAGTATTGCGAGGGGTCTCAAGAGAACTACTGTGACCAAGTGGAATTCAC
TTACAATGGCATCTTTTGGGATGGTAGCATCACTTATGGTGGCTACTCAAAAATGCTTGTTGCTGATCATAGGTACGTGGTACGTATACCAGATA
ACATGGCAATGGACAGAGCAGCACCATTATTATGTGCAGGAATAACAGTTTTTACTCCTTTGAAAGACAATAATTTGGTGGATACAAAAGGTAAA
AAAATAGGAATAATAGGTCTTGGTGGACTTGGACATGTAGCTGTCAAATTTGGAAAAGCATTTGGACATCATGTGACTGTCATTAGCACCTCTCC
AATCAAAGAACAAGAAGCCAAAGACAACTTAGGTGCTGATGATTTTATAATAAGCACTAATCCCAAACAAATGCTGGAAAAGAAAAGAACCCTAG
ACTTTATTTCGGATACAGTGTCAGGCAAACACTCACTTGGGAGTTACTTAGAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E619448] SGN-U285726 Solanum tuberosum Build 4 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T420324 [Download][View] Facility Assigned ID: bf_mxflxxxx_0023c10.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5