Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E619559

Search information 
Request: 619559Match: SGN-E619559
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C396572Clone name: 70251
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E619559Length: 468 bp (1048 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E619559 [] (trimmed) TAGAGAACCAACGCCAATGGGAGAGTGGGTGCTACTGCAGCTGTCTACTCTGCTGCAATCTTGGAGTATCTAACCGCGGAGGTATTGGAGCTGGC
TGGAAATGCAAGCAAGGATTTGAAGGTGAAACGTATCACCCCAAGACATTTGCAGCTAGCAATTCGAGGCGATGAAGAACTTGATACTCTGATCA
AAGGAACAATAGCTGGAGGAGGTGTTATACCGCACATTCACAAGTCGCTCATCAACAAATCTTCTAAGGAGTAATGGAAGTCTGTGTGCTTGCTA
CAACTAGACATAGAAATTGTTATGTTGGCATACTCTTTTTTCGAAAACTTTAACCCGTTGGTTTTGGTGTCTGCAAATGCATAGACATAGAATTG
TTATGCTGTGGCATATTTCGTGGTCCTTAGCTGACATACTAAATTTAATGTGATTGCCTGATTTCTTCTAAAAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E619559] SGN-U279414 Solanum tuberosum Build 4 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T420435 [Download][View] Facility Assigned ID: bf_mxflxxxx_0024e10.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0004 Quality Trim Threshold: 12.5