EST details — SGN-E619823

Search information 
Request: 619823Match: SGN-E619823
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C396836Clone name: 70517
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E619823Length: 325 bp (731 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E619823 [] (trimmed) CAAAAACAAACTCTCATTTCTCCAAAACACTTTCCTTTCTTTCCCTTTCATTTCTCACTAGTTAACATACTATTGTTGTCACATACACTCATAAA
AAAAATACTTTTTCTTCTAAGGAAGAAGAAGAAGAAATTCACACTTCTATCAAGAACTTAAAGGTTTCACCAGCAAATCTCTAACACATGTCGCG
ACTTGTATTTTTTCTCTTATTTTTTGTGGTGGCTACACCTATAACCAATGGATTAAATCCACGAAAACTCGATGAGGGTGAAAATAAATGTGGAG
GTTGTCCTTGTAACAAACCTTGTATTCCACCTTCTCCTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E619823] SGN-U272109 Solanum tuberosum Build 4 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T420699 [Download][View] Facility Assigned ID: bf_mxflxxxx_0027h08.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0028 Quality Trim Threshold: 20.5