Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E620617

Search information 
Request: 620617Match: SGN-E620617
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C397630Clone name: 71320
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E620617Length: 323 bp (1052 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E620617 [] (trimmed) TAGCCTAAGGAAACACAAAATGCTTTCAACATGATATTCATAACCACACTGACATGAGAAGAAAAAACAACTAGATAAAACTCCGCCTGCATCCA
GATCAACCCACAATAACAAATCTGCATCACTTTAAGCCTTGTTAGCAATGTTGTTAGAAAGCCAATCAAGTCCCTCGTAAAGCCCCTCTCCAGAA
GTTGCACAAGTGCTCTGGATGTACCAGTGACGCTGCCTGAGGGAGTGCAGTCCAAGCTTATCAGTTATTTCGGCAGCATTCATTGCATTAGGAAG
ATCTTGCTTGTTAGCAAAAACTAGAAGCACAGCATCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E620617] SGN-U268253 Solanum tuberosum Build 4 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T421493 [Download][View] Facility Assigned ID: bf_mxflxxxx_0037a03.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0025 Quality Trim Threshold: 12.5