EST details — SGN-E621375

Search information 
Request: 621375Match: SGN-E621375
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C399814Clone name: 75120
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E621375Length: 712 bp (803 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E621375 [] (trimmed) CGAGGGTTAGGGTAGGGGTATGGGTTGGCATACTCTCTACCCCTCTGGAGACGCAAGACGTCACTTTGTGGGAACTTATTATTGGGGGGCATTGG
TTGAATTCCCTGAAATGAAAATGGCGCTATGATGAGCAAAAATAAGTTCCAATGAAAATCAGGAAGAAACCTTTGGGGGAATTGCAGGATATGTT
GACGAAATGTTCAACAGTGATAATGGGATGTTTTCTTCTTCTCGGACTGGAACTCCTTCAATGTGTTCTACTTCATCGTCTACATCTTCCAGTGA
GACCTTTTTTACCTTTTCCAACAAAAGAAGTTCAGGTGAAATGAAGTCGGGTAAAGGCGATTCTTGCCAATTCCAAGGATTTTGTAGAAGGGGTG
GAACATCTGGAAAAAGCAATGAAAGAGAACGGAGTTGGAGGAAAAATTCCACGAGTGGACGGAAGCAATAGGATGGATGCTAAAAGGCAAAAGGT
TCTATACATGAGTTTTATCAAATTAAGGATAGGGAAAATGAATAGAACTGCAGCTAATCCATGTCTTTTTGTGGCTGTTGTTTCTTATTTAGGAT
CAGAGTTGTTTCTTTTTCACAGAAAGTAGCATCTTCTTTCAACTAGTGTATTGTAATTCTATCTACCTAAAAAACGTTTTCACCAGACATCAATT
ATCTTACCATTCCTAGTATTTCATAGCTTCAATTCTTTCTTCAATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E621375] SGN-U270209 Solanum tuberosum Build 4 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T424669 [Download][View] Facility Assigned ID: bf_mxflxxxx_0046a05.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0234 Quality Trim Threshold: 14.5