EST details — SGN-E622941

Search information 
Request: 622941Match: SGN-E622941
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C399604Clone name: 73314
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E622941Length: 189 bp (341 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E622941 [] (trimmed) TTGTGAGGATGTGATGACAAACGAGGAAGCTTGTGAAGTGGCTAGACGGACGAATTCTGCTGTGGCACAAAAAGAATGGGACTAACCCTCTGCCG
GAAAGGGGCCAGGGAGTGGATCCTGCTGGACAAGCAGCGGCAGAGTATCTTTCATCTATGGCTCTCCAAAAAGGTAGCAAAGACAATATATCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E622941] SGN-U273187 Solanum tuberosum Build 4 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T423467 [Download][View] Facility Assigned ID: bf_mxflxxxx_0063e04.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0254 Quality Trim Threshold: 14.5