EST details — SGN-E623086

Search information 
Request: 623086Match: SGN-E623086
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C400099Clone name: 88174
nocartOrdering Not Available
Library Name: MXFLOrganism: Solanum tuberosum

Tissue: Floral buds
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E623086Length: 782 bp (1021 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E623086 [] (trimmed) ATTTGATGTCTGTGGAAGCGCTCAGCTTCAGGTTTACTTCCCTGGCGAGAACATATTACTGGAGACTCAAAGGAAGAATGTGAGGACTTCAAGAG
ATTGGGTTGATGACAAATGGGTTGAAGTTGAGGGAAAGAAAGACATAAAGTCGTTCATAAGCTCGAGTTCAACTTATATATCCACGTGCAGTATC
AAAGAGCCAGGGAACTGCGAAAATCAGATGTCTCCCAAGCTTGTGGCATCTGAAGACAACAAAATGGCGTCAACTTCTAAACACTCAGCGGAGAA
GCAAGACACTGATGTGCTTAAACTGAAAAGGCGATGGTGTATTGATTTTCTTGCAGGTAACAAGAACTGATTTCAGACAATTCTACAAGTGATAA
TGCTGGCGTCTAGCAGTCGTCAGTTCTTTTCGATAACAGTGAAATGTTTTTGGCACTGTGGGTAATTCTCAACGGTGCTCGATTTGCCTTTGTAA
ATGTATAGGCCTTTGACAACAAAACATGGAAAAGGCATCTCATAGAGCTTTAGATAAGCAGTCTTTTTTCTTACCTCTCCCTAGTTGCTCGCACC
TTTTCGCTTCCTTGATAACTCGAACTCACAACCTCAAGGTTGGAAGTAGCTAGATGAGGGTGTTTATCATCCGAGCACACTCTTCTGGTTAGTAT
ATGTATGTGTNTTACAAATTCACCAAGAAGTTGGTATGCTCTTGTATTGTACACTCTCGCTATCGATTATACCATATCAATATAAGAAGTTGAAT
TACCATTTAATTCTAAGAAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E623086] SGN-U273472 Solanum tuberosum Build 4 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T423612 [Download][View] Facility Assigned ID: bf_mxflxxxx_0065c01.t3m
Submitter: Rebecca Griffiths Sequencing Facility: GASF
Funding Organization: Genome Atlantic
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0077 Quality Trim Threshold: 12.5