Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-E624636

Search information 
Request: 624636Match: SGN-E624636
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C401649Clone name: GI|1946811
nocartOrdering Not Available
Library Name: vSTmRNAOrganism: Solanum tuberosum

Tissue: Unknown
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E624636Length: 3066 bp (3066 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E624636 [] (trimmed) ATACAAAGAGAGAAAAATCTCTTTTCTTTCTTTCTTTCTTTTCTATTTCCCTAAATTTTCCCATTCATATATATATATATTTTTTTTAATTTCTC
AATAATCAATGGCGGCATCTGTTGAAAACAGGCAGTTCACTCACCTTGAACCGGGTTTATCAGGCGTAGGCCGTAATTTCAAGCCTAGGCCTGAT
TCCCCGGTTCGTGGTTGCAACTTCCCTCCGTCATCCAACCATGAACTCCCTTTCCAAAAACAACAAAATCTCCCCATTTACCTTGATTACTCGTC
TAGTGAAGACGAAGATGACGATGATGAAAAAAATGAATACGTTCAAATGATCAAAAAAGGTAAAACTGAATTAGAACCATCAATTCACGATACTA
GAGACGAAGGTACCGCTGATAATTGGATCCAACGAAACTTTTCCTTAATACGTCTCACCGGTAAACACCCATTCAACTCCGAACCCCCTTTGGCT
CGACTTATGCATCACGGTTTCATCACCCCAGTCCCACTTCATTACGTCCGTAACCATGGCCCCGTTCCCAAAGCCTCCTGGGCTGACTGGAGCGT
CGAAGTAACCGGGCTAGTAAAACGACCAATGAAATTCACAATGGATCAGCTGGTTAACGAATTTCCTTCACGTGAATTGCCTGTCACACTTGTAT
GTGCTGGCAATCGTCGGAAAGAGCAGAATATGGTTAAGCAGACGATTGGTTTCAACTGGGGTGCTGCTGCAGTTTCAACTACCGTATGGCGCGGA
GTACCCCTCCGCCCGTTGTTGAAACGGTGCGGTGTTCATAGTAAGAAAAAAGGTGCGCTTAACATCTGTTTCGAAGGTTCAGATGTTTTACCTGG
AGGTGGAGGTTCAAAGTACGGAACGAGTATAAAGAAGGAATTCGCCATGGATCCATCTCGTGATATTATTGTAGCTTACATGCAAAACGGAGAAA
TGTTGAGCCCGGATCACGGGTTTCCGGTAAGGATGATTATTCCGGGATTCATAGGTGGAAGAATGGTGAAATGGCCAAAGAGGATTGTGGTCACT
ACACAAGAATCAGAAAGCTATTATCATTACAAGGATAATAGAGTCCTCCCTCCACATGTTGAGCTCGAACTTGCTAACGCTGAAGCATGGTGGTA
CAAACCAGAGTACATCATCAATGAGCTCAACATCAACTCTGTCATTACAACTCCGTCCCATGAAGAAATTTTGCCTATTAATGCGTGGACTACTC
AGCGACCTTACACGTTGAGAGGCTATGCTTATCCCGGTGGAGGTAAAAAGGTAACTCGAGTGGAAGTGACTTTGGATGGAGGAGAGACATGGAGT
GTGTGTACACTTGATCACCCAGAGAAGCCAACTAAGTATGGCAAGTACTGGTGTTGGTGCTTTTGGTCACTTGAGGTTGAGGTGCTCGACTTGCT
TAGAGCTAAAGAAATTGCTGTACGAGCTATCGATGAGACCCACAATACTCAACCCGAGAAGCTTATTTGGAACGTCATGGGAATGATGAACAATT
GTTGGTTTCGAGTGAAGATGAAGTGTGTCAAGCCTCACAAGGGAGAGATTGGTATAGTGTTTGAGCACCCGACCCAACCTGGAAACCAATCAGGT
GGATGGATGGCAAAGGAGAGACACTTGGAGATATCAGCAGTGGCTCCTCCAACACTAAAGAAGAGTATTTCAACTCCTTTCATGAACACAGCTTC
GAAGATGTATTCCATGTCTGAGGTGAGGAAGCACAACTCTTCAGACTCTGCTTGGATCATAGTCCATGGACATATCTACGATGCCTCACGTTTCT
TGAAAGACCATCCTGGTGGTGTTGACAGCATTCTCATCAATGCTGGAACTGATTGTACTGAGGAATTTGATGCAATTCATTCTGATAAGGCTAAG
AAGCTATTGGAGGACTTTAGGATTGGTGAACTCATAACTACTGGTTACACGTCTGATTCGTCTCCAAACACGTCTGTCCACGGATCCTCTTCCAT
TAGTAGCTTCTTAGCACCTATTAAGGAACTTGTTCAAACACCAACAAGGAGTGTAGCCCTCATCCCAAGGGAAAAAATCCCTTGCAAACTCGTCG
ACAAGCAATCCATCTCCCATGATGTTAGAAAATTCAAATTTGCATTACCCTCTGAGGATCAAGTCTTAGGCTTACCTGTTGGCAAACACATTTTC
CTCTGTGCCACAGTTGATGACAAACTCTGCATGCGTGCCTACACGCCTACTAGCACAGTCGATGAAGTAGGGTTCTTCGAGTTGGTTGTCAAAGT
CTACTTCAAAGGAGTTCACCCTAAATTCCCTAATGGAGGTCAAATGTCACAACATCTTGATTCTCTCCCAATAGGTGCATTCCTTGACGTTAAAG
GTCCATTAGGTCACATTGAATACCAAGGCAAGGGTAATTTCTTAGTCCATGGTAAACAAAAGTTTCCGAAGAAGTTAGCTATGATAGCTGGTGGA
ACAGGTATAACTCCTGTATATCAAGTAATCGAATCAATTTTGAAAGATCCAGAAGACGACACAGAAATGTATGTGGTGTATGCAAACAGAACAGA
GGACGATATTTTGCTCAAAGAGGAACTCGATGCATGGGCAGAGCAAATCCCAGATAGAGTTAAAGTTTGGTATGTCGTTCAAGAATCAATTACAG
AAGGATGGAAGTATAGTACAGGATTTGTTACAGAAGCAATTCTCAGAGAACATATACCTCAACCATCTCATACAACATTGGCATTGGCTTGTGGA
CCACCTCCTATGATACAATTTGCTATTAATCCAAACTTGGAGAAAATGGGATATGACATTAAGGAGGAATTATTGGTGTTCTAAATTGGATGATG
ATCATATATTTCTGGTGGAATAAATTCCTTTTTGTTTTTCATTTGTACATATTGTACTTCTTGTAGTTCTTGAAATTTTAATTTTCTATTTTTTC
TTGTTAACTTTAGGTATAAAATGTTGTACTCTCTACTAGTATGTGTATGTCAAAATTAAGTTGTAATATTCATCATGGAATTATAGTAACTTTTA
TGGTGAAAAAAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E624636] SGN-U271417 Solanum tuberosum Build 4 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T425512 [Download][View] Facility Assigned ID:
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: