EST details — SGN-E626142
| Search information |
| Request: 626142 | Match: SGN-E626142 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C414276 | Clone name: cccp7m6 |
| ||
| Library Name: cccp | Organism: Coffea canephora |
Tissue: Pericarp
Development Stage: All development stages combined
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E626142 | Length: 181 bp (568 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E626142 [] (trimmed)
GCTCGTCTCGGGATCCTATGTGCTATCAGCTCCCTCTTCCTCTTTCTCAATCCTTCCAATATCTTCTACTCACCAACCCCTTCAGAGCCACCCTG
CTTCTTTCTTTAACGATAGTCTCCGAATTATTAACTTTCTGAGAGTTTTCCAGCTCAGCTTGTCTGTTTTATTTGTCGCTTTTACT
CTTCTTTCTTTAACGATAGTCTCCGAATTATTAACTTTCTGAGAGTTTTCCAGCTCAGCTTGTCTGTTTTATTTGTCGCTTTTACT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E626142] | SGN-U621249 | Coffea canephora | Build 3 | 1 ESTs assembled | |
| [SGN-E626142] | SGN-U638730 | Coffee species | Build 1 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T438139 [Download] [View] | Facility Assigned ID: cccp7m6.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |
Working
