EST details — SGN-E627056

Search information 
Request: 627056Match: SGN-E627056
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C414838Clone name: cccp26c16
nocartOrdering Not Available
Library Name: cccpOrganism: Coffea canephora

Tissue: Pericarp
Development Stage: All development stages combined

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E627056Length: 573 bp (1022 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E627056 [] (trimmed) GGATGCTATTCATGTTTTCAAGGTAGAAATGCCCCAGATGGGGGTTGCCCCAAGTACATCAACGTACAATACAATGATTTCAATGCTTTGTCAGC
AGGAACGAGAAGAATTGGCGTTGGAGTTTCTCAGGGATATGGAAAAGTCGACTTATTGTAAGCCTGAAGTGCAGACATATTTTCCTCTGCTCAAG
GCATGCTTTAAAGGTGGAAACAAAGATGATCGCTTGAGTATGCTGCTGGATGAGATGTCTAGCAAGCATCATCTGAGTTTTGATTTGTCAACTTA
TGCACTTCTGGTCCATGGGCTGTGCAAAGTAAATAAACCTGAAGAGGCATATAATTACTTCACGAAAATGATAGCTCAAGACATAACCCCTCGAT
ATGTTACCTGTCGCTTACTCCTGGATGAACTTAGACAAAACAAGAAGCATGATGCTGCTACGAGGGTTGAAGACTTCATGAAGAAAATGAAATCC
TCTTGACCATCAACATTTCTTGGTATTGTGCTTTTATGGCCTCAATTAACTAGCTAACACTCGTACCATATAAATCCACACAAGGGCCCGGATCT
CTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E627056] SGN-U626406 Coffea canephora Build 3 1 ESTs assembled
[SGN-E627056] SGN-U642373 Coffee species Build 1 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T438701 [Download] [View] Facility Assigned ID: cccp26c16.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15