EST details — SGN-E627703
Search information |
Request: 627703 | Match: SGN-E627703 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C438633 | Clone name: cccs30w10l3 |
| ||
Library Name: cccs30w | Organism: Coffea canephora |
Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E627703 | Length: 203 bp (1075 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E627703 [] (trimmed)
GTAAATTTAGCCCAATTTTTTCCCACCCTCTAAATTCGCCTTTCTTTGATTCTCTCTTCTCTTGTCGTCCATCGATCCGACTGGTGAGGTTTATT
TTTGTAGGGATCGGAGGTGGATTAGGGAAATTGGGGGTGATTAATTGAGGAATTTTGAGGTGAATTATAATTACAAGGATTCGAAGATGTTTTTG
TTGGATTGGTTCT
TTTGTAGGGATCGGAGGTGGATTAGGGAAATTGGGGGTGATTAATTGAGGAATTTTGAGGTGAATTATAATTACAAGGATTCGAAGATGTTTTTG
TTGGATTGGTTCT
Unigenes |
Current Unigene builds | |||||
[SGN-E627703] | SGN-U617771 | Coffea canephora | Build 3 | 18 ESTs assembled | |
[SGN-E627703] | SGN-U632786 | Coffee species | Build 1 | 38 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T462496 [Download] [View] | Facility Assigned ID: cccs30w10l3.i |
Submitter: None | Sequencing Facility: Cornell |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |