EST details — SGN-E628462

Search information 
Request: 628462Match: SGN-E628462
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C415715Clone name: cccp11m6
nocartOrdering Not Available
Library Name: cccpOrganism: Coffea canephora

Tissue: Pericarp
Development Stage: All development stages combined

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E628462Length: 461 bp (564 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E628462 [] (trimmed) GCAGCAATGACCTTGCATGGGTCCCATGCAGCGGCTGCACAGGCTGCTCCTCTACCGTATTTTCTCCGAACACTTCCACTAGTTATGCGGCTTCC
GACTGTTCCTTGCCGGAATGTACTCAAGTCCGCGGACTCTCTTGCCCGACCACCGGTGCCGGTGCTTGCTTATTCAACCAGTCCTACGGCGGAGA
TTCGTCGTTTTCCGCTACGCTGTCGCATGATTCTCTGACGTTTGGGCCCGATGTGGTTCCGAATTATGCTTTCGGATGCATAACTGCAGTCTCCG
GTGGGTCAATACCGCCCCAAGGTCTGTTGGGTTTGGGCCGAGGCTCCTTGTCCTTGCTCTCTCAATCCGGCTCACTATACTCCGGGGTGTTCTCG
TACTGCTTGCCCAGCTTCCGGTCATACTACTTTTCTGGATCACTCAAACTTGGGCCGGTGGGTCAGCCCAAGAGCATCAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E628462] SGN-U619972 Coffea canephora Build 3 7 ESTs assembled
[SGN-E628462] SGN-U633819 Coffee species Build 1 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T439578 [Download] [View] Facility Assigned ID: cccp11m6.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15